eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| gastrointestinal stromal tumor | ||||
| Disease ID | 157 |
|---|---|
| Disease | gastrointestinal stromal tumor |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:11) C1963106 | esophagitis C1527249 | colorectal cancer C1519670 | tumor angiogenesis C0521610 | emphysematous cholecystitis C0494165 | liver metastases C0341215 | gastroduodenal intussusception C0149927 | pulmonary hamartoma C0026764 | multiple myeloma C0023321 | lentigines C0018802 | congestive heart failure C0010043 | ulcerative keratitis |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:3) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:64) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs1056836 | 23637977 | 1545 | CYP1B1 | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.000271442 | 2013 | CYP1B1 | 2 | 38071060 | G | C |
| rs1056836 | 23637977 | 3815 | KIT | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.760239544 | 2013 | CYP1B1 | 2 | 38071060 | G | C |
| rs113488022 | 19561230 | 673 | BRAF | umls:C0238198 | BeFree | V600E BRAF mutations are alternative early molecular events in a subset of KIT/PDGFRA wild-type gastrointestinal stromal tumours. | 0.011801484 | 2009 | BRAF | 7 | 140753336 | A | T,G,C |
| rs113488022 | 20023270 | 6635 | SNRPE | umls:C0238198 | BeFree | BRAF V600E detection in the tumor does not induce a higher expression of the B-raf protein or the preferential activation of the p42/44 mitogen-activated protein kinase (MAPK) signaling pathway compared with GISTs without the BRAF mutation. | 0.000271442 | 2010 | BRAF | 7 | 140753336 | A | T,G,C |
| rs113488022 | 18615679 | 673 | BRAF | umls:C0238198 | BeFree | Novel V600E BRAF mutations in imatinib-naive and imatinib-resistant gastrointestinal stromal tumors. | 0.011801484 | 2008 | BRAF | 7 | 140753336 | A | T,G,C |
| rs113488022 | 23343956 | 673 | BRAF | umls:C0238198 | BeFree | We constructed tissue microarrays of formalin-fixed and paraffin-embedded specimens of 534 gastroesophageal tumors (119 squamous cell cancers and 72 adenocarcinomas of the esophagus, 63 cancers of the gastroesophageal junction/cardia, 199 gastric cancers of the corpus or antrum, 81 gastric gastrointestinal stromal tumors) and performed anti-BRAF-V600E immunostaining using the mutation-specific antibody VE1. | 0.011801484 | 2014 | BRAF | 7 | 140753336 | A | T,G,C |
| rs113488022 | 19561230 | 5156 | PDGFRA | umls:C0238198 | BeFree | V600E BRAF mutations are alternative early molecular events in a subset of KIT/PDGFRA wild-type gastrointestinal stromal tumours. | 0.615647294 | 2009 | BRAF | 7 | 140753336 | A | T,G,C |
| rs113488022 | 26486743 | 673 | BRAF | umls:C0238198 | BeFree | Utility of BRAF V600E mutation-specific immunohistochemistry in detecting BRAF V600E-mutated gastrointestinal stromal tumors. | 0.011801484 | 2016 | BRAF | 7 | 140753336 | A | T,G,C |
| rs121908585 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 3342 | HTC2 | umls:C0238198 | BeFree | We performed an association study between copy number alterations (CNAs) identified from array CGH and gene expression analyses results for four wild-type GISTs and an imatinib-resistant PDGFRA D842V mutant GIST, and compared the results to those obtained from 27 GISTs with KIT mutations. | 0.001085767 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 22743760 | 5156 | PDGFRA | umls:C0238198 | BeFree | The choice also should be personalized on the basis of genotype: generally, PDGFRA D842V mutated and wild-type GIST are excluded. | 0.615647294 | 2012 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 15221957 | 3815 | KIT | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.760239544 | 2004 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 22745105 | 5156 | PDGFRA | umls:C0238198 | BeFree | Crenolanib inhibits the drug-resistant PDGFRA D842V mutation associated with imatinib-resistant gastrointestinal stromal tumors. | 0.615647294 | 2012 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 15613856 | 5156 | PDGFRA | umls:C0238198 | BeFree | PDGFRA exon 18 mutations (total 86 cases) were common in epithelioid GISTs and most commonly represented a D842V point mutation; none of these was prognostically significant. | 0.615647294 | 2005 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 10993 | SDS | umls:C0238198 | BeFree | mRNA expression levels of all SDH gene subunits were significantly lower (P≤0.041), whereas mRNA expression levels of VEGF (P=0.025), IGF1R (P=0.026), and ZNFs (P<0.05) were significantly higher in GISTs with wild-type/PDGFRA D842V mutations than GISTs with KIT mutations. | 0.002442977 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 6390 | SDHB | umls:C0238198 | BeFree | mRNA expression levels of all SDH gene subunits were significantly lower (P≤0.041), whereas mRNA expression levels of VEGF (P=0.025), IGF1R (P=0.026), and ZNFs (P<0.05) were significantly higher in GISTs with wild-type/PDGFRA D842V mutations than GISTs with KIT mutations. | 0.249510397 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 15221957 | 5156 | PDGFRA | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.615647294 | 2004 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 1757 | SARDH | umls:C0238198 | BeFree | mRNA expression levels of all SDH gene subunits were significantly lower (P≤0.041), whereas mRNA expression levels of VEGF (P=0.025), IGF1R (P=0.026), and ZNFs (P<0.05) were significantly higher in GISTs with wild-type/PDGFRA D842V mutations than GISTs with KIT mutations. | 0.002442977 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 7422 | VEGFA | umls:C0238198 | BeFree | mRNA expression levels of all SDH gene subunits were significantly lower (P≤0.041), whereas mRNA expression levels of VEGF (P=0.025), IGF1R (P=0.026), and ZNFs (P<0.05) were significantly higher in GISTs with wild-type/PDGFRA D842V mutations than GISTs with KIT mutations. | 0.005438769 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 3480 | IGF1R | umls:C0238198 | BeFree | mRNA expression levels of all SDH gene subunits were significantly lower (P≤0.041), whereas mRNA expression levels of VEGF (P=0.025), IGF1R (P=0.026), and ZNFs (P<0.05) were significantly higher in GISTs with wild-type/PDGFRA D842V mutations than GISTs with KIT mutations. | 0.003257302 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24618081 | 81608 | FIP1L1 | umls:C0238198 | BeFree | Activated forms of the platelet derived growth factor receptor alpha (PDGFRα) have been described in various tumors, including FIP1L1-PDGFRα in patients with myeloproliferative diseases associated with hypereosinophilia and the PDGFRα(D842V) mutant in gastrointestinal stromal tumors and inflammatory fibroid polyps. | 0.000271442 | 2014 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24618081 | 5156 | PDGFRA | umls:C0238198 | BeFree | Activated forms of the platelet derived growth factor receptor alpha (PDGFRα) have been described in various tumors, including FIP1L1-PDGFRα in patients with myeloproliferative diseases associated with hypereosinophilia and the PDGFRα(D842V) mutant in gastrointestinal stromal tumors and inflammatory fibroid polyps. | 0.615647294 | 2014 | PDGFRA | 4 | 54285926 | A | T |
| rs121908585 | 24124608 | 5156 | PDGFRA | umls:C0238198 | BeFree | qRT-PCR validation of the GSTT1 results in this cohort and 11 additional malignant GISTs showed a significant increase in the frequency of GSTT1 CN gain and increased mRNA expression of GSTT1 in wild-type/PDGFRA D842V GISTs than KIT-mutant GISTs (P=0.033). | 0.615647294 | 2013 | PDGFRA | 4 | 54285926 | A | T |
| rs121908586 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54274869 | T | A |
| rs121908586 | 17566086 | 5156 | PDGFRA | umls:C0238198 | BeFree | The patient was found to carry a germline PDGFRA mutation (V561D) in the heterozygote state; it has only been seen rarely before and only in the somatic state in sporadic GISTs. | 0.615647294 | 2007 | PDGFRA | 4 | 54274869 | T | A |
| rs121908586 | 15221957 | 5156 | PDGFRA | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.615647294 | 2004 | PDGFRA | 4 | 54274869 | T | A |
| rs121908586 | 15221957 | 3815 | KIT | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.760239544 | 2004 | PDGFRA | 4 | 54274869 | T | A |
| rs121913234 | NA | 3815 | KIT | umls:C0238198 | CLINVAR | NA | 0.760239544 | NA | KIT | 4 | 54727416 | AAACCCATGTATGAAGTACAGTGGAAG | - |
| rs121913235 | 23291969 | 5156 | PDGFRA | umls:C0238198 | BeFree | Overall, we identified six novel mutations in KIT (p.K550_M552delinsL, p.Q556_W557delinsG p.Q556_G575del, p.W557_V559delinsQ p.P573_R588dup, p.G592_K593dup) and one novel mutation in PDGFRA (p.D842_N848delinsVDV), thus contributing to widening the spectrum of known mutations in GIST tumors and confirming the most frequently altered regions underlying GIST development. | 0.615647294 | 2012 | KIT | 4 | 54727437 | T | A,C,G |
| rs121913235 | 23291969 | 3815 | KIT | umls:C0238198 | BeFree | Overall, we identified six novel mutations in KIT (p.K550_M552delinsL, p.Q556_W557delinsG p.Q556_G575del, p.W557_V559delinsQ p.P573_R588dup, p.G592_K593dup) and one novel mutation in PDGFRA (p.D842_N848delinsVDV), thus contributing to widening the spectrum of known mutations in GIST tumors and confirming the most frequently altered regions underlying GIST development. | 0.760239544 | 2012 | KIT | 4 | 54727437 | T | A,C,G |
| rs121913271 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54274883 | AGCCCAGATGGACATGAA | CGC |
| rs121913506 | 23480638 | 3815 | KIT | umls:C0238198 | BeFree | Intermittent and continuous imatinib in a human GIST xenograft model carrying KIT exon 17 resistance mutation D816H. | 0.760239544 | 2013 | KIT | 4 | 54733154 | G | C,T |
| rs121913507 | 16912224 | 3815 | KIT | umls:C0238198 | BeFree | Whereas KIT juxtamembrane domain mutations seen in most patients with GIST are highly sensitive to imatinib, the kinase activation loop mutant D816V, frequently encountered in SM, hampers the binding ability of imatinib. | 0.760239544 | 2007 | KIT | 4 | 54733155 | A | T |
| rs121913507 | 24128084 | 3815 | KIT | umls:C0238198 | BeFree | A KIT mutation was identified in six cases (67%), including three with the D816V mutation typical of adult-onset disease, and another three with an internal tandem duplication (p.A502_Y503dup) in exon 9, previously described in gastrointestinal stromal tumour. | 0.760239544 | 2013 | KIT | 4 | 54733155 | A | T |
| rs121913512 | 17824795 | 3815 | KIT | umls:C0238198 | BeFree | Imatinib in the management of multiple gastrointestinal stromal tumors associated with a germline KIT K642E mutation. | 0.760239544 | 2007 | KIT | 4 | 54728055 | A | G |
| rs121913513 | 19723893 | 3815 | KIT | umls:C0238198 | BeFree | Activate and resist: L576P-KIT in GIST. | 0.760239544 | 2009 | KIT | 4 | 54727495 | T | C |
| rs121913513 | 23598963 | 3815 | KIT | umls:C0238198 | BeFree | A novel germline KIT mutation (p.L576P) in a family presenting with juvenile onset of multiple gastrointestinal stromal tumors, skin hyperpigmentations, and esophageal stenosis. | 0.760239544 | 2013 | KIT | 4 | 54727495 | T | C |
| rs121913516 | 23773153 | 3815 | KIT | umls:C0238198 | BeFree | Herein, by introducing adaptive elements into the inhibitor core structure, we undertake the structure-based development of type II hybrid inhibitors to overcome gatekeeper drug-resistant mutations in cSrc-T338M, as well as clinically relevant tyrosine kinase KIT-T670I and Abl-T315I variants, as essential targets in gastrointestinal stromal tumors (GISTs) and chronic myelogenous leukemia (CML). | 0.760239544 | 2014 | KIT | 4 | 54729353 | C | T |
| rs121913516 | 15946589 | 3815 | KIT | umls:C0238198 | BeFree | The reported mechanism of imatinib resistance in GISTs involves missense mutation in the kinase domain of KIT, including Thr670Ile, Tyr823Asp, and Val654Ala. | 0.760239544 | 2005 | KIT | 4 | 54729353 | C | T |
| rs121913517 | 17363509 | 3815 | KIT | umls:C0238198 | BeFree | We expressed c-KIT cDNA constructs encoding the V654A substitution alone and in combination with a typical activating exon 11 mutation characteristic of GIST, V560G, in factor-dependent FDC-P1 cells. | 0.760239544 | 2007 | KIT | 4 | 54727444 | T | A,C,G |
| rs121913517 | NA | 3815 | KIT | umls:C0238198 | CLINVAR | NA | 0.760239544 | NA | KIT | 4 | 54727444 | T | A,C,G |
| rs121913520 | 17259998 | 3815 | KIT | umls:C0238198 | BeFree | These results suggest that different mutations, even at the same codon, in juxtamembrane domain of the c-kit gene show different inhibitory effects of imatinib, and that patients with GISTs or mast cell neoplasms possessing this Val559Ile mutation are resistant to imatinib therapy. | 0.760239544 | 2007 | KIT | 4 | 54727443 | G | A |
| rs121913521 | 17363509 | 3815 | KIT | umls:C0238198 | BeFree | We expressed c-KIT cDNA constructs encoding the V654A substitution alone and in combination with a typical activating exon 11 mutation characteristic of GIST, V560G, in factor-dependent FDC-P1 cells. | 0.760239544 | 2007 | KIT | 4 | 54727447 | T | A,G |
| rs121913521 | 15221957 | 5156 | PDGFRA | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.615647294 | 2004 | KIT | 4 | 54727447 | T | A,G |
| rs121913521 | 15221957 | 3815 | KIT | umls:C0238198 | BeFree | Previously, we found 2 types of gain-of-function mutation of the PDGFRA gene, Val561 to Asp and Asp842 to Val, in about half of GISTs without c-kit gene mutations. | 0.760239544 | 2004 | KIT | 4 | 54727447 | T | A,G |
| rs121913523 | 15946589 | 3815 | KIT | umls:C0238198 | BeFree | The reported mechanism of imatinib resistance in GISTs involves missense mutation in the kinase domain of KIT, including Thr670Ile, Tyr823Asp, and Val654Ala. | 0.760239544 | 2005 | KIT | 4 | 54728092 | T | C |
| rs121913523 | 17363509 | 3815 | KIT | umls:C0238198 | BeFree | We expressed c-KIT cDNA constructs encoding the V654A substitution alone and in combination with a typical activating exon 11 mutation characteristic of GIST, V560G, in factor-dependent FDC-P1 cells. | 0.760239544 | 2007 | KIT | 4 | 54728092 | T | C |
| rs1800440 | 23637977 | 1545 | CYP1B1 | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.000271442 | 2013 | CYP1B1 | 2 | 38070996 | T | G,C |
| rs1800440 | 23637977 | 3815 | KIT | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.760239544 | 2013 | CYP1B1 | 2 | 38070996 | T | G,C |
| rs1801131 | NA | 4524 | MTHFR | umls:C0238198 | CLINVAR | NA | 0.12 | NA | MTHFR | 1 | 11794419 | T | G |
| rs1801133 | NA | 4524 | MTHFR | umls:C0238198 | CLINVAR | NA | 0.12 | NA | MTHFR | 1 | 11796321 | G | A |
| rs1801394 | NA | 4552 | MTRR | umls:C0238198 | CLINVAR | NA | 0.12 | NA | MTRR;FASTKD3 | 5 | 7870860 | A | G |
| rs2855658 | 23637977 | 1545 | CYP1B1 | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.000271442 | 2013 | CYP1B1;RMDN2 | 2 | 38069747 | T | C |
| rs2855658 | 23637977 | 3815 | KIT | umls:C0238198 | BeFree | Although none of the association p-values were statistically significant after adjustment for multiple comparisons, SNPs in CYP1B1 were strongly associated with KIT exon 11 codon 557-8 deletions (OR = 1.9, 95% CI: 1.3-2.9 for rs2855658 and OR = 1.8, 95% CI: 1.2-2.7 for rs1056836) and wild type GISTs (OR = 2.7, 95% CI: 1.5-4.8 for rs1800440 and OR = 0.5, 95% CI: 0.3-0.9 for rs1056836). | 0.760239544 | 2013 | CYP1B1;RMDN2 | 2 | 38069747 | T | C |
| rs28933968 | 9438854 | 3815 | KIT | umls:C0238198 | UNIPROT | GISTs may originate from the interstitial cells of Cajal (ICCs) because the development of ICCs is dependent on the SCF-KIT interaction and because, like GISTs, these cells express both KIT and CD34. | 0.760239544 | 1998 | NA | NA | NA | NA | NA |
| rs397516835 | NA | 6390 | SDHB | umls:C0238198 | CLINVAR | NA | 0.249510397 | NA | SDHB | 1 | 17024040 | C | T,G |
| rs587776653 | NA | 6391 | SDHC | umls:C0238198 | CLINVAR | NA | 0.244624443 | NA | SDHC | 1 | 161356841 | G | A,T |
| rs587776792 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54285927 | CATCATGCATGA | - |
| rs587776793 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54285934 | CATGATTCGAAC | - |
| rs587776794 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54274868 | - | AGAGGG |
| rs587776795 | NA | 5156 | PDGFRA | umls:C0238198 | CLINVAR | NA | 0.615647294 | NA | PDGFRA | 4 | 54274866 | GGGTCATTGAATCAA | - |
| rs587776803 | NA | 3815 | KIT | umls:C0238198 | CLINVAR | NA | 0.760239544 | NA | KIT | 4 | 54727444 | TTGTTG | - |
| rs587776804 | NA | 3815 | KIT | umls:C0238198 | CLINVAR | NA | 0.760239544 | NA | KIT | 4 | 54727420 | CCATGTATGAAGTAC | - |
| rs74315368 | NA | 6390 | SDHB | umls:C0238198 | CLINVAR | NA | 0.249510397 | NA | SDHB | 1 | 17022648 | C | T |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:9) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0100833 | Neoplasm of the small intestine | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
| HP:0002239 | Gastrointestinal hemorrhage | MP:0012305 | umbilical cord hemorrhage | bleeding into or from the umbilical cord |
| HP:0006753 | Neoplasm of the stomach | MP:0009536 | abnormal interstitial cell of Cajal morphology | any structural anomaly in the type of cell found in the gastrointestinal tract and serving as a pacemaker that triggers gut contraction; ICCs mediate inputs from the enteric nervous system to smooth muscle cells and are thought to be the cells from which |
| HP:0001392 | Abnormality of the liver | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0100723 | Gastrointestinal stroma tumor | MP:0010279 | increased gastrointestinal tumor incidence | greater than the expected number of tumors originating in the gastrointestinal system in a given population in a given time period |
| HP:0005214 | Intestinal obstruction | MP:0003587 | ureter obstruction | a partial or total blockage in any part of the ureter causing obstruction of urine flow from the kidney to the urinary bladder; may be congenital, acquired, unilateral, bilateral, acute or chronic |
| HP:0100273 | Neoplasm of the colon | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
| HP:0002017 | Nausea and vomiting | MP:0010426 | abnormal heart and great artery attachment | any anomaly in the in the position or pattern of the connection site of the heart to any of the great arteries, including the pulmonary artery and aorta |
| HP:0100743 | Neoplasm of the rectum | MP:0008261 | arrest of male meiosis | cessation of the progression of the process of nuclear division that results in sperm with one half the normal chromosome number of the original cell |
Mapped by homologous gene(Total Items:18) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0005214 | Intestinal obstruction | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0100723 | Gastrointestinal stroma tumor | MP:0014166 | ectopic cranial bone | the appearance of an extra bone structure at an atypical location in or near the cranium |
| HP:0100273 | Neoplasm of the colon | MP:0014083 | blunted small intestinal villi | abnormal flattening of the surface of the tiny hair-like projections which protrude from the inside of the small intestine and contain blood vessels that capture digested nutrients that are absorbed through the intestinal wall; usually due to intestinal d |
| HP:0006753 | Neoplasm of the stomach | MP:0020039 | increased bone ossification | increase in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0100743 | Neoplasm of the rectum | MP:0014083 | blunted small intestinal villi | abnormal flattening of the surface of the tiny hair-like projections which protrude from the inside of the small intestine and contain blood vessels that capture digested nutrients that are absorbed through the intestinal wall; usually due to intestinal d |
| HP:0007400 | Irregular hyperpigmentation | MP:0014171 | increased fatty acid oxidation | increased rate or incidence of the process of removal of one or more electrons from a fatty acid, with or without the concomitant removal of a proton or protons, by reaction with an electron-accepting substance, by addition of oxygen or by removal of hydr |
| HP:0001903 | Anemia | MP:0020316 | decreased vascular endothelial cell proliferation | decrease in the expansion rate of any vascular endothelial cell population by cell division |
| HP:0100833 | Neoplasm of the small intestine | MP:0014083 | blunted small intestinal villi | abnormal flattening of the surface of the tiny hair-like projections which protrude from the inside of the small intestine and contain blood vessels that capture digested nutrients that are absorbed through the intestinal wall; usually due to intestinal d |
| HP:0001392 | Abnormality of the liver | MP:0020169 | increased thyroid gland weight | higher than average weight of the thyroid gland |
| HP:0002015 | Dysphagia | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0002019 | Constipation | MP:0020234 | decreased basal metabolism | decrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state |
| HP:0007378 | Neoplasm of the gastrointestinal tract | MP:0013310 | abnormal adrenal gland development | aberrant formation or incomplete differentiation of the pair of endocrine glands located above the kidney that are responsible for steroid hormone secretion from the cortex and neurotransmitter (such as epinephrine and norepinephrine) secretion from the m |
| HP:0002239 | Gastrointestinal hemorrhage | MP:0020215 | impaired blood coagulation | impaired ability of the blood to clot |
| HP:0100242 | Sarcoma | MP:0020329 | decreased capillary density | reduction in the number of capillaries in a given cross-sectional area of a tissue |
| HP:0012378 | Fatigue | MP:0013659 | abnormal erythroid lineage cell morphology | any structural anomaly of an immature or mature cell in the lineage leading to and including erythrocytes |
| HP:0002017 | Nausea and vomiting | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0100751 | Esophageal neoplasm | MP:0013502 | decreased fibroblast apoptosis | reduction in the timing or the number of fibroblast cells undergoing programmed cell death |
| HP:0000988 | Skin rash | MP:0020154 | impaired humoral immune response | impaired response of the immune system that mediates secreted antibodies produced in B cells |
| Disease ID | 157 |
|---|---|
| Disease | gastrointestinal stromal tumor |
| Case | (Waiting for update.) |